In silico Design of sgRNA for CRISPR/Cas9-Mediated MLO Gene Mutagenesis to Reduce Powdery Mildew Susceptibility in Vitis vinifera

Abstract

Powdery mildew (Erysiphe necator) poses a severe threat to Vitis vinifera (grapevine) cultivation worldwide, causing substantial yield and quality losses. Conventional fungicide-based management raises sustainability concerns and risks of pathogen resistance. The Mildew Locus O (MLO) gene family, which encodes transmembrane proteins functioning as negative regulators of plant immunity, represents a compelling target for durable disease resistance through loss-of-function mutagenesis. This study presents a comprehensive in silico workflow for the design and evaluation of single-guide RNAs (sgRNAs) for CRISPR/Cas9-mediated mutagenesis of VvMLO7 (Accession: EU591726) in grapevine. Using the CHOPCHOP v3 tool, 18 candidate sgRNAs were generated and filtered based on GC content (35–65%), self-complementarity, predicted on-target efficiency, and off-target mismatch scores. Two optimal sgRNAs were selected: sgRNA1 (GTGGGGACACACCATTCGAGTGG; efficiency 65.95%) and sgRNA2 (TCCCGTGTTCACTTATTGCAAGG; efficiency 59.05%). Secondary structure analysis via RNAfold confirmed canonical stem-loop conformations with minimum free energies of ?28.60 and ?27.40 kcal/mol, respectively. Both sgRNAs were integrated into a pCas9-TPC plant-compatible vector incorporating homology-directed repair (HDR) donor sequences and a GFP selection marker. This in silico framework provides a rational, cost-effective foundation for experimental validation and advances precision breeding approaches for sustainable viticulture.

Introduction

Vitis vinifera (grapevine) is a globally important fruit crop, but its production is severely affected by powdery mildew, caused by Erysiphe necator. This disease reduces yield, damages fruit quality, and increases dependence on chemical fungicides, which raises environmental concerns and can lead to fungicide-resistant pathogen strains.

Plant susceptibility to powdery mildew is strongly linked to the Mildew Locus O (MLO) gene family, which encodes proteins that suppress plant immune responses. When these genes lose their function, plants develop durable and broad-spectrum resistance known as mlo resistance. Because of this, disrupting MLO genes has become a promising strategy for improving disease resistance in crops.

This study focuses on designing a CRISPR/Cas9-based genome editing system to target the VvMLO7 gene in Vitis vinifera. CRISPR/Cas9 uses a single-guide RNA (sgRNA) to direct the Cas9 enzyme to a specific DNA sequence, where it creates a double-strand break. The break is repaired by cellular mechanisms such as non-homologous end joining (NHEJ) or homology-directed repair (HDR), allowing targeted mutations.

Using computational (in silico) methods, the researchers retrieved the VvMLO7 sequence from the NCBI database and designed sgRNAs with the CHOPCHOP tool. Out of 18 candidates, two sgRNAs were selected based on optimal GC content, high predicted editing efficiency (≈59–66%), zero self-complementarity, and low off-target risk. RNAfold analysis confirmed that both sgRNAs form stable secondary structures suitable for Cas9 binding.

An in silico CRISPR/Cas9 plasmid vector was then constructed using the pCas9-TPC backbone. The design included two sgRNA expression cassettes under the AtU6-26 promoter, a donor DNA template with homology arms for HDR-mediated editing, and a GFP reporter gene for identifying transformed cells.

Overall, the study establishes a systematic computational pipeline for designing CRISPR/Cas9 components to knock out the VvMLO7 gene in grapevine. Disrupting this susceptibility gene could potentially generate grapevine varieties with durable resistance to powdery mildew. However, experimental validation—such as transformation, sequencing, and disease resistance testing—is required to confirm the effectiveness and safety of the proposed system.

Conclusion

This study presents a comprehensive in silico framework for CRISPR/Cas9-mediated mutagenesis of the VvMLO7 susceptibility gene in Vitis vinifera. The pipeline encompasses target gene retrieval, sgRNA design and filtering, secondary structure validation, and expression vector construction. Two high-efficiency sgRNAs — GTGGGGACACACCATTCGAGTGG (65.95% efficiency) and TCCCGTGTTCACTTATTGCAAGG (59.05% efficiency) — were identified and confirmed to form stable secondary structures compatible with Cas9 binding. A complete expression vector incorporating dual sgRNAs, an HDR donor template, and a GFP selection marker was designed in silico using the pCas9-TPC backbone. This work provides a rational, cost-effective foundation for experimental validation and represents a significant step toward developing powdery mildew-resistant grapevine cultivars through precision genome editing. The elimination or reduction of MLO7 susceptibility gene function may confer durable, chemical-free resistance, reducing the ecological footprint of grapevine cultivation and advancing sustainable viticulture practices. Future efforts should focus on experimental transformation, phenotypic validation of resistance, and assessment of potential off-target effects in edited plant lines.

References

[1] Gadoury, D. M., Cadle-Davidson, L., Wilcox, W. F., Dry, I. B., Seem, R. C., & Milgroom, M. G. (2012). Grapevine powdery mildew: A fascinating system for the study of the biology, ecology and epidemiology of an obligate biotroph. Molecular Plant Pathology, 13(1), 1–16. https://doi.org/10.1111/j.1364-3703.2011.00726.x [2] Bortesi, L., & Fischer, R. (2015). The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances, 33(1), 41–52. https://doi.org/10.1016/j.biotechadv.2014.12.006 [3] Feechan, A., Jermakow, A. M., Torregrosa, L., Panstruga, R., & Dry, I. B. (2008). Identification of grapevine MLO gene candidates involved in susceptibility to powdery mildew. Functional Plant Biology, 35(12), 1255–1266. https://doi.org/10.1071/FP08173 [4] Büschges, R., Hollricher, K., Panstruga, R., Simons, G., Wolter, M., Frijters, A., van Daelen, R., van der Lee, T., Diergaarde, P., Groenendijk, J., Töpsch, S., Vos, P., Salamini, F., & Schulze-Lefert, P. (1997). The barley Mlo gene: A novel control element of plant pathogen resistance. Cell, 88(5), 695–705. https://doi.org/10.1016/S0092-8674(00)81912-1 [5] Doudna, J. A., & Charpentier, E. (2014). The new frontier of genome engineering with CRISPR-Cas9. Science, 346(6213), Article 1258096. https://doi.org/10.1126/science.1258096 [6] Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816–821. https://doi.org/10.1126/science.1225829 [7] Xiang, G., Zhang, X., An, C., Cheng, C., & Wang, H. (2019). Temperature effect on CRISPR-Cas9 mediated genome editing. Journal of Genetics and Genomics, 44(4), 199–205. https://doi.org/10.1016/j.jgg.2017.03.004 [8] Bae, S., Park, J., & Kim, J.-S. (2014). Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics, 30(10), 1473–1475. https://doi.org/10.1093/bioinformatics/btu048 [9] Kusch, S., & Panstruga, R. (2017). mlo-based resistance: An apparently universal \"weapon\" to defeat powdery mildew disease. Molecular Plant-Microbe Interactions, 30(3), 179–189. https://doi.org/10.1094/MPMI-12-16-0255-CR [10] Wang, Y., Cheng, X., Shan, Q., Zhang, Y., Liu, J., Gao, C., & Qiu, J.-L. (2014). Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nature Biotechnology, 32(9), 947–951. https://doi.org/10.1038/nbt.2969 [11] Malnoy, M., Viola, R., Jung, M.-H., Koo, O.-J., Kim, S., Kim, J.-S., Velasco, R., & Nagamangala Kanchiswamy, C. (2016). DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Frontiers in Plant Science, 7, Article 1904. https://doi.org/10.3389/fpls.2016.01904 [12] Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., & Valen, E. (2019). CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research, 47(W1), W171–W174. https://doi.org/10.1093/nar/gkz365 [13] Lorenz, R., Bernhart, S. H., Höner zu Siederdissen, C., Tafer, H., Flamm, C., Stadler, P. F., & Hofacker, I. L. (2011). ViennaRNA Package 2.0. Algorithms for Molecular Biology, 6(1), Article 26. https://doi.org/10.1186/1748-7188-6-26 [14] Dahan-Meir, T., Filler-Hayut, S., Melamed-Bessudo, C., Bocobza, S., Czosnek, H., & Levy, A. A. (2018). Efficient in planta gene targeting in tomato using geminiviral replicons and the CRISPR/Cas9 system. Plant Journal, 95(1), 5–16. https://doi.org/10.1111/tpj.13932 [15] Pessina, S., Pavan, S., Catalano, D., Gallotta, A., Visser, R. G. F., Bai, Y., Malnoy, M., & Schouten, H. J. (2016). Knockdown of MLO genes reduces susceptibility to powdery mildew in grapevine. Horticulture Research, 3, Article 16022. https://doi.org/10.1038/hortres.2016.22 [16] Zhang, Y., Liang, Z., Zong, Y., Wang, Y., Liu, J., Chen, K., Qiu, J.-L., & Gao, C. (2016). Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA. Nature Communications, 7, Article 12617. https://doi.org/10.1038/ncomms12617

Copyright

Copyright © 2026 Aafreen Sayed, Vaibhav Shivade, Annika Gupta, Mugdha Pathak, Sneha Dokhale. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.